| Year |
Citation |
Score |
| 2018 |
Dvorkin SA, Karsisiotis AI, Webba da Silva M. Encoding canonical DNA quadruplex structure. Science Advances. 4: eaat3007. PMID 30182059 DOI: 10.1126/Sciadv.Aat3007 |
0.587 |
|
| 2017 |
Deacon OM, Karsisiotis AI, Moreno Chicano T, Hough MA, Macdonald CJ, Blumenschein T, Wilson MT, Moore GR, Worrall JAR. Heightened dynamics of the oxidized Y48H variant of human cytochrome c increases its peroxidatic activity. Biochemistry. PMID 29083920 DOI: 10.1021/Acs.Biochem.7B00890 |
0.355 |
|
| 2017 |
Dvorkin SA, Karsisiotis AI, Silva MWd. DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium Journal of Back and Musculoskeletal Rehabilitation. DOI: 10.2210/Pdb5J05/Pdb |
0.577 |
|
| 2016 |
Karsisiotis AI, Deacon OM, Wilson MT, Macdonald C, Blumenschein TM, Moore GR, Worrall JA. Increased dynamics in the 40-57 Ω-loop of the G41S variant of human cytochrome c promote its pro-apoptotic conformation. Scientific Reports. 6: 30447. PMID 27461282 DOI: 10.1038/Srep30447 |
0.317 |
|
| 2016 |
Montagner C, Nigen ME, Jacquin O, Willet N, Dumoulin M, Karsisiotis AI, Roberts GC, Damblon C, Redfield C, Matagne AE. The role of active site flexible loops in catalysis and of zinc in conformational stability of Bacillus cereus 569/H/9 β-lactamase. The Journal of Biological Chemistry. PMID 27235401 DOI: 10.1074/Jbc.M116.719005 |
0.329 |
|
| 2015 |
Karsisiotis AI, Deacon OM, Rajagopal BS, Macdonald C, Blumenschein TM, Moore GR, Worrall JA. Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states. Biomolecular Nmr Assignments. PMID 26123826 DOI: 10.1007/S12104-015-9621-3 |
0.309 |
|
| 2014 |
Karsisiotis AI, Dillon P, Silva MWd. Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. Journal of Back and Musculoskeletal Rehabilitation. DOI: 10.2210/Pdb2Mfu/Pdb |
0.473 |
|
| 2014 |
Karsisiotis AI, Silva MWd. Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. Journal of Back and Musculoskeletal Rehabilitation. DOI: 10.2210/Pdb2M6V/Pdb |
0.473 |
|
| 2013 |
Karsisiotis AI, Damblon CF, Roberts GC. Solution structures of the Bacillus cereus metallo-β-lactamase BcII and its complex with the broad spectrum inhibitor R-thiomandelic acid. The Biochemical Journal. 456: 397-407. PMID 24059435 DOI: 10.1042/Bj20131003 |
0.34 |
|
| 2013 |
Karsisiotis AI, O'Kane C, Webba da Silva M. DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Methods (San Diego, Calif.). 64: 28-35. PMID 23791747 DOI: 10.1016/J.Ymeth.2013.06.004 |
0.639 |
|
| 2012 |
Karsisiotis AI, Silva MWd. Structural probes in quadruplex nucleic acid structure determination by NMR. Molecules. 17: 13073-13086. PMID 23128087 DOI: 10.3390/Molecules171113073 |
0.401 |
|
| 2011 |
Karsisiotis AI, Hessari NM, Novellino E, Spada GP, Randazzo A, Silva MWd. Topological Characterization of Nucleic Acid G‐Quadruplexes by UV Absorption and Circular Dichroism Angewandte Chemie. 50: 10645-10648. PMID 21928459 DOI: 10.1002/Anie.201105193 |
0.43 |
|
| 2008 |
Liénard BM, Garau G, Horsfall L, Karsisiotis AI, Damblon C, Lassaux P, Papamicael C, Roberts GC, Galleni M, Dideberg O, Frère JM, Schofield CJ. Structural basis for the broad-spectrum inhibition of metallo-beta-lactamases by thiols. Organic & Biomolecular Chemistry. 6: 2282-94. PMID 18563261 DOI: 10.1039/B802311E |
0.338 |
|
| Show low-probability matches. |